Stem-loop sequence mtr-MIR399b

AccessionMI0001743 (change log)
DescriptionMedicago truncatula miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399b
(24 sentences)

Stem-loop
   ----------------          ug     a           uaugg   ua    auuu 
5'                 ucauagggca  ucucu uugguagguga     uga  uuuc    g
                   ||||||||||  ||||| |||||||||||     |||  ||||     
3'                 agugucccgu  agagg aaccguucacu     acu  ggag    a
   acaaauucgauuugug          cg     a           uaaag   uc    auua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 21517100-21517211 [-]
intergenic
chr6: 21556911-21557022 [-]
intergenic
Database links

Mature sequence mtr-miR399b

Accession MIMAT0001645
Sequence

73 - 

ugccaaaggagagcugcccug

 - 93

Get sequence
Evidence by similarity; MI0001022

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).