Stem-loop sequence mtr-MIR399d

AccessionMI0001744 (change log)
DescriptionMedicago truncatula miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399d
(22 sentences)

Stem-loop
   uaaag     a  u  g  a       ug     a           uauggugauauuucauuu 
5'      uaagc aa ca uc uagggca  ucucu uuggcagguga                  g
        ||||| || || || |||||||  ||||| |||||||||||                   
3'      auucg uu gu ag aucccgu  agagg aaccguucacu                  a
   -acaa     a  u  g  c       cg     a           uaaaaaucucggaauuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 21504277-21504405 [-]
intergenic
Database links

Mature sequence mtr-miR399d

Accession MIMAT0001646
Sequence

90 - 

ugccaaaggagagcugcccua

 - 110

Get sequence
Evidence by similarity; MI0001022

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).