Stem-loop sequence mtr-MIR395a

AccessionMI0001746 (change log)
DescriptionMedicago truncatula miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395a
(12 sentences)

Stem-loop
   uuuu     a   uu   u          ug          gc    -    aug     gg      a 
5'     uguug uug  ucu agaguuccuu  aacgcuucau  auga gaau   uauuu  ucuaau u
       ||||| |||  ||| ||||||||||  ||||||||||  |||| ||||   |||||  ||||||  
3'     acgac aac  ggg ucucaagggg  uugugaagua  uacu cuug   auaga  agauua c
   -acc     c   uu   u          gu          ac    u    ---     aa      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16610555-16610689 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR395a
mtr-MIR395dchr5: 16616400-16616494 [-]
mtr-MIR395achr5: 16610555-16610689 [-]
mtr-MIR395echr5: 16605860-16605959 [-]
Database links

Mature sequence mtr-miR395a

Accession MIMAT0001648
Sequence

96 - 

augaaguguuugggggaacuc

 - 116

Get sequence
Evidence experimental; Northern [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).