Stem-loop sequence mtr-MIR395b

AccessionMI0001747 (change log)
DescriptionMedicago truncatula miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395b
(12 sentences)

Stem-loop
   uacu         -uc   u          ug         ---    u   a a    -    a 
5'     uguugauuu   ucu ggaguuccuc  aaugcuuca   aaca gag c aucu ugau g
       |||||||||   ||| ||||||||||  |||||||||   |||| ||| | |||| ||||  
3'     acaacuaag   agg ucucaagggg  uuaugaagu   uugu cuu g uagg auua a
   --au         uua   u          gu         aac    u   - a    u    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16653454-16653577 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR395b
mtr-MIR395ichr5: 16656267-16656342 [-]
mtr-MIR395bchr5: 16653454-16653577 [-]
Database links

Mature sequence mtr-miR395b

Accession MIMAT0001649
Sequence

85 - 

augaaguauuugggggaacuc

 - 105

Get sequence
Evidence by similarity; MI0001043

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).