Stem-loop sequence mtr-MIR399c

AccessionMI0001748 (change log)
DescriptionMedicago truncatula miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399c
(22 sentences)

Stem-loop
   guucu     ug  g    a     a                 ga    uaaaaa    a 
5'      gcugu  ag aaug uaggg aaaucucuuuuggcaga  ggag      ucuu a
        |||||  || |||| ||||| |||||||||||||||||  ||||      ||||  
3'      cgaca  uu uuac guccc uuuagaggaaaccguuu  ucuu      agga a
   guuau     gu  -    c     g                 gg    --ugua    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 24010865-24010983 [-]
intergenic
chr8: 24182595-24182713 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399c
mtr-MIR399cchr8: 24182595-24182713 [-]
mtr-MIR5246chr8: 24180980-24181049 [-]
mtr-MIR399kchr8: 24176682-24176775 [-]
mtr-MIR399jchr8: 24173628-24173718 [+]
mtr-MIR399rchr8: 24012653-24012754 [+]
mtr-MIR399cchr8: 24010865-24010983 [-]
mtr-MIR5246chr8: 24009245-24009314 [-]
mtr-MIR399kchr8: 24004937-24005030 [-]
mtr-MIR399jchr8: 24001880-24001970 [+]
Database links

Mature sequence mtr-miR399c

Accession MIMAT0001650
Sequence

80 - 

ugccaaaggagauuugcccug

 - 100

Get sequence
Evidence by similarity; MI0001054

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).