Stem-loop sequence mtr-MIR399e

AccessionMI0001750 (change log)
DescriptionMedicago truncatula miR399e stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399e
(22 sentences)

Stem-loop
   ucca       guu    ua a   ug   u    a         a  uagc     ua    --a     
5'     aguugca   gaau  c ggg  agu cucc uuggcaggu gc    cacua  ugau   ugca 
       |||||||   ||||  | |||  ||| |||| ||||||||| ||    |||||  ||||   ||| u
3'     ucaacgu   cuua  g ccc  uua gagg aaccgucua ug    gugau  acua   acgu 
   -auc       acu    gc a   gu   -    a         a  ---u     uc    cua     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 23175117-23175250 [-]
intergenic
chr8: 23978156-23978289 [+]
intergenic
chr8: 24145178-24145311 [+]
intergenic
chr8: 24214214-24214347 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399e
mtr-MIR399fchr8: 24222878-24222981 [+]
mtr-MIR399echr8: 24214214-24214347 [+]
mtr-MIR399fchr8: 24153821-24153924 [+]
mtr-MIR399echr8: 24145178-24145311 [+]
mtr-MIR399fchr8: 23986801-23986904 [+]
mtr-MIR399echr8: 23978156-23978289 [+]
mtr-MIR399echr8: 23175117-23175250 [-]
mtr-MIR399fchr8: 23166508-23166611 [-]
Database links

Mature sequence mtr-miR399e

Accession MIMAT0001652
Sequence

95 - 

ugccaaaggagauuugcccag

 - 115

Get sequence
Evidence by similarity; MI0001059

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).