Stem-loop sequence mtr-MIR319a

AccessionMI0001751 (change log)
Previous IDsmtr-MIR319
DescriptionMedicago truncatula miR319 stem-loop
Gene family MIPF0000010; MIR159
Literature search

5 open access papers mention mtr-MIR319a
(22 sentences)

Stem-loop
   auua   g       u    a                 cu  u       u      uuu  a      g   ac     g  u  aa        -ac    a 
5'     uua aaauaga gaag gagcuuccuucagucca  ca ggaaggg aagggg   ga uuaccu cug  ucauu au ca  cacaauag   aauu u
       ||| ||||||| |||| |||||||||||||||||  || ||||||| ||||||   || |||||| |||  ||||| || ||  ||||||||   ||||  
3'     aau uuuaucu uuuc cucgagggaagucaggu  gu ucuucuu uuccuu   uu agugga gac  aguaa ug gu  guguuauc   uugg g
   auua   a       u    c                 uc  u       -      -cu  a      g   gu     g  u  aa        gua    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 31290518-31290724 [+]
intergenic
Database links

Mature sequence mtr-miR319a-5p

Accession MIMAT0026556
Sequence

21 - 

agagcuuccuucaguccacuc

 - 41

Get sequence
Evidence experimental; Illumina [3]

Mature sequence mtr-miR319a-3p

Accession MIMAT0001653
Previous IDsmtr-miR319
Sequence

169 - 

uuggacugaagggagcuccc

 - 188

Get sequence
Evidence experimental; 454 [2], Illumina [3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).
3
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).