Stem-loop sequence mtr-MIR156a

AccessionMI0001752 (change log)
Previous IDsmtr-MIR156
DescriptionMedicago truncatula miR156 stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention mtr-MIR156a
(77 sentences)

Stem-loop
   agccau  --au   uc  a     c      -        aca    cc     acaaguaacaaaaaacuaccaacuaucaacauuuugucuacuaugaagaaaaucacaugucuagacuauaguuacgaauggaagauacauucaaugauguuuaugaaaauuugagacggucgaggacuauaguuacucuaucgcauacauuuaaugacaaaaaaaauuguguacucuua 
5'       ga    cag  cg gauga agaaga gagagagc   ccca  ugauu                                                                                                                                                                                   u
         ||    |||  || ||||| |||||| ||||||||   ||||  |||||                                                                                                                                                                                    
3'       cu    guc  gu uuacu ucuucu cuuucucg   gggu  acuaa                                                                                                                                                                                   u
   ---ccu  gacc   cc  g     c      u        --a    --     gacaacccuccuuaaggaguguuccauuuugaacugagaaugaauaacguuuuagauuacuaaaaaaaugguacuauaaaugaaaaaaacuuguuaaaaaaaugguacuauaacuuacguuaaaaaauaugacguaaaacuaagaacguaucuuuaacuuacuucuacauaacuuuuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
contig_50145: 402-861 [-]
intergenic
Database links

Mature sequence mtr-miR156a

Accession MIMAT0001654
Previous IDsmtr-miR156
Sequence

21 - 

ugacagaagagagagagcaca

 - 41

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).