Stem-loop sequence mtr-MIR171a

AccessionMI0001753 (change log)
Previous IDsmtr-MIR171
DescriptionMedicago truncatula miR171 stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

8 open access papers mention mtr-MIR171a
(53 sentences)

Stem-loop
   ugaauuccccuc     --uu          u  u        a  c    uu  ug   
5'             cgcuu    ugauguuggc ug cucaauca au aaag  cu  aa 
               |||||    |||||||||| || |||||||| || ||||  ||  | a
3'             gcgaa    acuauaaccg gc gaguuagu ug uuuc  ga  uu 
   ---cugaaaaua     uuau          u  u        c  a    uu  gu   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
contig_164461: 1012-1125 [-]
intergenic
Database links

Mature sequence mtr-miR171a

Accession MIMAT0001655
Previous IDsmtr-miR171
Sequence

75 - 

ugauugagucgugccaauauc

 - 95

Get sequence
Evidence by similarity; MI0001137

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).