Stem-loop sequence gma-MIR319a

AccessionMI0001782 (change log)
DescriptionGlycine max miR319a stem-loop
Gene family MIPF0000010; MIR159
Literature search

21 open access papers mention gma-MIR319a
(58 sentences)

Stem-loop
   cguuga    ccu    -u   a     uu          cuc     u   ag            a -  g   ac       uc  aa           agcg 
5'       agac   aagg  aag gagcu  cuucagucca   auggg gac  uaagauucaauu g cu ccg  ucauuca  ca  uguugagugua    a
         ||||   ||||  ||| |||||  ||||||||||   ||||| |||  |||||||||||| | || |||  |||||||  ||  |||||||||||     
3'       ucug   uucc  uuc cucga  gaagucaggu   ugucc uug  auucuaaguuaa c ga ggc  aguaagu  gu  acgacucauau    a
   -cauuc    -uu    uu   c     gg          uca     u   -a            a a  g   gu       ga  ag           aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 39506583-39506789 [-]
intergenic
Database links

Mature sequence gma-miR319a

Accession MIMAT0001684
Sequence

169 - 

uuggacugaagggagcuccc

 - 188

Get sequence
Evidence experimental; 454 [1,3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).