Stem-loop sequence gma-MIR398a

AccessionMI0001787 (change log)
DescriptionGlycine max miR398a stem-loop
Gene family MIPF0000107; MIR398
Literature search

15 open access papers mention gma-MIR398a
(78 sentences)

Stem-loop
   ---------------        a    a               cu    ug a  gc       u 
5'                cucggagg guga ucugagaacacaagg  gguu  c cu  uauauca c
                  |||||||| |||| |||||||||||||||  ||||  | ||  ||||||| u
3'                gaguuucc cacu ggacucuuguguuuc  uuaa  g ga  auauggu a
   uacaguuguccaacc        c    -               au    gu -  --       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 7214749-7214864 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR398a
gma-MIR398achr1: 7214749-7214864 [-]
gma-MIR2119chr1: 7214478-7214613 [-]
Database links

Mature sequence gma-miR398a

Accession MIMAT0001689
Sequence

77 - 

uguguucucaggucaccccuu

 - 97

Get sequence
Evidence by similarity; MI0001017

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).