Stem-loop sequence gma-MIR398b

AccessionMI0001788 (change log)
DescriptionGlycine max miR398b stem-loop
Gene family MIPF0000107; MIR398
Literature search

15 open access papers mention gma-MIR398b
(74 sentences)

Stem-loop
   -a   caaau    uau        a   g                cu    ug a  gc       uga 
5'   guc     gguu   cucagagg gug aucugagaacacaagg  gguu  c cu  uauauua   u
     |||     ||||   |||||||| ||| ||||||||||||||||  ||||  | ||  |||||||    
3'   cag     ccaa   gaguuucc cac uggacucuuguguuuc  uuaa  g ga  auauggu   c
   ua   -uugu    -cc        c   -                au    gu -  --       uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 11080996-11081130 [-]
intergenic
Database links

Mature sequence gma-miR398b-5p

Accession MIMAT0037314
Sequence

24 - 

gaguggaucugagaacacaagg

 - 45

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR398b-3p

Accession MIMAT0001690
Sequence

96 - 

uguguucucaggucaccccuu

 - 116

Get sequence
Evidence by similarity; MI0001017

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2