Stem-loop sequence gma-MIR319c

AccessionMI0001789 (change log)
DescriptionGlycine max miR319c stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319c
(47 sentences)

Stem-loop
   uug       -a      u            c    c   uu        uaacgaaagauuggguugcugaauuaacugcuagcucacacauucauucauacaauaguau 
5'    ggaggga  agagag gaaggagcuucc ucag cca  cauggaga                                                             u
      |||||||  |||||| |||||||||||| |||| |||  ||||||||                                                              
3'    ccucccu  ucuuuu cuuccucgaggg aguc ggu  gugucucu                                                             c
   --a       cg      u            a    a   uc        uucucccaagguuauaucuaugauauaugagggcgaaguaaguguguuauaaugggauuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 45231920-45232140 [-]
intergenic
Database links

Mature sequence gma-miR319c

Accession MIMAT0001691
Sequence

183 - 

uuggacugaagggagcuccu

 - 202

Get sequence
Evidence experimental; 454 [1], Illumina [3-4]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
4