Stem-loop sequence sbi-MIR166g

AccessionMI0001853 (change log)
DescriptionSorghum bicolor miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

5 open access papers mention sbi-MIR166g
(12 sentences)

Stem-loop
   --uc    u  g  ua              uu      cu  gg            -  ---a   uu     
5'     augc cg au  gguuagggggauug  gucugg  cg  gucuccggucga ga    ucc  ggcc 
       |||| || ||  ||||||||||||||  ||||||  ||  |||||||||||| ||    |||  ||| u
3'     uacg gc ua  ccaauuucccuaac  cggacc  gc  uagaggccaguu cu    agg  ccgu 
   gauu    -  g  --              uu      ag  uu            g  guug   --     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 64857514-64857647 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR166g
sbi-MIR166fchr4: 64857783-64857921 [-]
sbi-MIR166gchr4: 64857514-64857647 [-]
Database links

Mature sequence sbi-miR166g

Accession MIMAT0001755
Sequence

95 - 

ucggaccaggcuucaaucccu

 - 115

Get sequence
Evidence by similarity; MI0001107

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).