Stem-loop sequence dre-let-7a-5

AccessionMI0001862
Previous IDsdre-let-7a-6
DescriptionDanio rerio let-7a-5 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gua  ug    u    u ugg      u          gu         ---u g    -    au 
5'    cg  uuuu ggug c   acaagg gagguaguag  uguauaguu    g uggg aggg  c
      ||  |||| |||| |   |||||| ||||||||||  |||||||||    | |||| ||||   
3'    gu  ggaa ccac g   uguucc uuccguuauc  acauaucaa    c acuu uccc  a
   --c  cu    u    u ---      -          ug         uagu g    g    aa 
Get sequence
Deep sequencing
880 reads, 346 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
23: 5478470-5478593 [-]
intergenic
Clustered miRNAs
< 10kb from dre-let-7a-5
dre-let-7e23: 5478692-5478791 [-]
dre-let-7a-523: 5478470-5478593 [-]
Database links

Mature sequence dre-let-7a

Accession MIMAT0001759
Sequence

28 - 

ugagguaguagguuguauaguu

 - 49

Get sequence
Deep sequencing19838 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).