Stem-loop sequence dre-let-7c-2

AccessionMI0001867 (change log)
DescriptionDanio rerio let-7c-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

40 open access papers mention dre-let-7c-2
(206 sentences)

Stem-loop
         a      cu   g   u             ---  ga   a 
5' gugugc uccagg  gag uag agguuguaugguu   uc  aug c
   |||||| ||||||  ||| ||| |||||||||||||   ||  |||  
3' cacaug agguuc  uuc auc uccaacaugucaa   ag  uac a
         -      cu   g   u             uug  gg   c 
Get sequence
Deep sequencing
311468 reads, 2.14e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 38072077-38072168 [-]
intergenic
Clustered miRNAs
< 10kb from dre-let-7c-2
dre-mir-99-2chr10: 38074312-38074391 [-]
dre-let-7c-2chr10: 38072077-38072168 [-]
Database links

Mature sequence dre-let-7c-5p

Accession MIMAT0001761
Previous IDsdre-let-7c
Sequence

15 - 

ugagguaguagguuguaugguu

 - 36

Get sequence
Deep sequencing622827 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-let-7c-3p

Accession MIMAT0031930
Sequence

60 - 

cuguacaaccuucuagcuuucc

 - 81

Get sequence
Deep sequencing268 reads, 10 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).