Stem-loop sequence dre-let-7d-1

AccessionMI0001868 (change log)
DescriptionDanio rerio let-7d-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

42 open access papers mention dre-let-7d-1
(277 sentences)

Stem-loop
   u    -       u u   g   uu            uu  auaauaa 
5'  gugc guugcgg g gag uag  gguuguaugguu  gc       a
    |||| ||||||| | ||| |||  ||||||||||||  ||       c
3'  cacg cggcguc c uuc auc  ccaacaugucaa  ug       a
   g    u       c u   g   uu            -u  aggcccg 
Get sequence
Deep sequencing
225717 reads, 1.58e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 24881122-24881218 [+]
intergenic
Database links

Mature sequence dre-let-7d-5p

Accession MIMAT0001762
Previous IDsdre-let-7d
Sequence

15 - 

ugagguaguugguuguaugguu

 - 36

Get sequence
Deep sequencing447651 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-let-7d-3p

Accession MIMAT0031931
Sequence

63 - 

cuguacaaccuucuagcuuucc

 - 84

Get sequence
Deep sequencing266 reads, 9 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).