Stem-loop sequence dre-let-7e

AccessionMI0001871 (change log)
Previous IDsdre-let-7e;dre-let-7e-1
DescriptionDanio rerio let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

42 open access papers mention dre-let-7e
(201 sentences)

Stem-loop
         --       cu   gu         a        ---------     c 
5' gcuguu  cuugggg  gag  aguagauug auaguugu         ggagc c
   ||||||  |||||||  |||  ||||||||| ||||||||         ||||| u
3' cgacag  gaauccu  uuc  ucaucuaac uaucaaua         ucucg g
         cg       --   ug         a        gagucucuc     c 
Get sequence
Deep sequencing
58098 reads, 3.7e+03 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 5431418-5431517 [-]
intergenic
Clustered miRNAs
< 10kb from dre-let-7e
dre-let-7echr23: 5431418-5431517 [-]
dre-let-7a-5chr23: 5431196-5431319 [-]
Database links

Mature sequence dre-let-7e

Accession MIMAT0001763
Sequence

15 - 

ugagguaguagauugaauaguu

 - 36

Get sequence
Deep sequencing115766 reads, 11 experiments
Evidence experimental;

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).