Stem-loop sequence dre-let-7f

AccessionMI0001872 (change log)
DescriptionDanio rerio let-7f stem-loop
Gene family MIPF0000002; let-7
Literature search

39 open access papers mention dre-let-7f
(198 sentences)

Stem-loop
   -ug   ---a     g g   u ug                      ---------       u 
5'    gua    ugcuu u cag g  agguaguagauuguauaguugu         aggguag g
      |||    ||||| | ||| |  ||||||||||||||||||||||         ||||||| a
3'    cau    acggg a guc c  uccguuaucuaacauaucaaua         uccuauu u
   aca   aaag     g -   - cu                      gaagaugug       u 
Get sequence
Deep sequencing
281563 reads, 1.93e+04 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr11: 27503017-27503132 [-]
intergenic
Clustered miRNAs
< 10kb from dre-let-7f
dre-let-7a-1chr11: 27503232-27503320 [-]
dre-let-7fchr11: 27503017-27503132 [-]
Database links

Mature sequence dre-let-7f

Accession MIMAT0001764
Sequence

20 - 

ugagguaguagauuguauaguu

 - 41

Get sequence
Deep sequencing280881 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).