Stem-loop sequence dre-let-7g-2

AccessionMI0001874 (change log)
DescriptionDanio rerio let-7g-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

39 open access papers mention dre-let-7g-2
(206 sentences)

Stem-loop
       --         u   gu     u          ----uua     ac 
5' gugg  acuguggga gag  aguag uuguauaguu       ggauc  a
   ||||  ||||||||| |||  ||||| ||||||||||       |||||   
3' cgcc  uggcacccu uuc  ucauc gacauaucaa       ucuag  c
       au         -   ug     u          uagaggg     ac 
Get sequence
Deep sequencing
253758 reads, 1.74e+04 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 28536361-28536457 [+]
sense
OTTDART00000038190 ; huwe1-001; intron 56
ENSDART00000146990 ; huwe1-001; intron 56
ENSDART00000006657 ; huwe1-201; intron 57
KZ115692.1: 496642-496738 [+]
sense
OTTDART00000038190 ; huwe1-001; intron 56
ENSDART00000146990 ; huwe1-001; intron 56
ENSDART00000006657 ; huwe1-201; intron 57
Clustered miRNAs
< 10kb from dre-let-7g-2
dre-let-7g-2chr23: 28536361-28536457 [+]
dre-let-7hchr23: 28536665-28536778 [+]
Database links

Mature sequence dre-let-7g

Accession MIMAT0001765
Sequence

14 - 

ugagguaguaguuuguauaguu

 - 35

Get sequence
Deep sequencing507024 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).