Stem-loop sequence dre-let-7h

AccessionMI0001875 (change log)
DescriptionDanio rerio let-7h stem-loop
Gene family MIPF0000002; let-7
Literature search

39 open access papers mention dre-let-7h
(197 sentences)

Stem-loop
   --    ugg           u                 u      -------    a   gua 
5'   gagu   cuguguugugg gagguaguaaguugugu guuguu       gggg uca   u
     ||||   ||||||||||| ||||||||||||||||| ||||||       |||| |||    
3'   cuca   gacguaauacc uuccgucauuuaacaua caauag       uccc ggu   a
   cu    ---           -                 u      aggaagu    -   aug 
Get sequence
Deep sequencing
22415 reads, 1.83e+03 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 28536665-28536778 [+]
sense
OTTDART00000038190 ; huwe1-001; intron 56
ENSDART00000146990 ; huwe1-001; intron 56
ENSDART00000006657 ; huwe1-201; intron 57
KZ115692.1: 496946-497059 [+]
sense
OTTDART00000038190 ; huwe1-001; intron 56
ENSDART00000146990 ; huwe1-001; intron 56
ENSDART00000006657 ; huwe1-201; intron 57
Clustered miRNAs
< 10kb from dre-let-7h
dre-let-7g-2chr23: 28536361-28536457 [+]
dre-let-7hchr23: 28536665-28536778 [+]
Database links

Mature sequence dre-let-7h

Accession MIMAT0001766
Sequence

19 - 

ugagguaguaaguuguguuguu

 - 40

Get sequence
Deep sequencing22225 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).