Stem-loop sequence dre-mir-9-2

AccessionMI0001881
DescriptionDanio rerio miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gcucuccucuggugacuu    acu        u   g   uc               g     g  u c 
5'                   uugc   uggaggcg guu uua  uuugguuaucuagcu uauga ug g u
                     ||||   |||||||| ||| |||  ||||||||||||||| ||||| || |  
3'                   aacg   aucuucgc cga aau  aagccaauagaucga auacu gc c g
   ---cguuacgagguaugc    acu        -   g   ga               a     -  - g 
Get sequence
Deep sequencing
3162 reads, 340 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
10: 45056132-45056267 [-]
intergenic
Database links

Mature sequence dre-miR-9-5p

Accession MIMAT0001769
Previous IDsdre-miR-9
Sequence

42 - 

ucuuugguuaucuagcuguauga

 - 64

Get sequence
Deep sequencing26892 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

Mature sequence dre-miR-9-3p

Accession MIMAT0003156
Previous IDsdre-miR-9*
Sequence

80 - 

uaaagcuagauaaccgaaagu

 - 100

Get sequence
Deep sequencing13102 reads, 4 experiments
Evidence experimental; array [2], in-situ [2]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).