Stem-loop sequence dre-mir-9-3

AccessionMI0001883 (change log)
DescriptionDanio rerio miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Literature search

22 open access papers mention dre-mir-9-3
(213 sentences)

Stem-loop
   --------uca        g     -  c               g     --  ua 
5'            ggggguug uuucu cu uuugguuaucuagcu uauga  gu  u
              |||||||| ||||| || ||||||||||||||| |||||  ||   
3'            cccuuaau aaaga ga aagccaauagaucga auacu  ca  a
   gguuucuaaaa        -     u  -               a     gu  ca 
Get sequence
Deep sequencing
50133 reads, 1.6e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr25: 8551240-8551340 [-]
intergenic
Database links

Mature sequence dre-miR-9-5p

Accession MIMAT0001769
Previous IDsdre-miR-9
Sequence

19 - 

ucuuugguuaucuagcuguauga

 - 41

Get sequence
Deep sequencing220384 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-9-3p

Accession MIMAT0003156
Previous IDsdre-miR-9*
Sequence

57 - 

uaaagcuagauaaccgaaagu

 - 77

Get sequence
Deep sequencing93449 reads, 11 experiments
Evidence experimental; array [2], in-situ [2]
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).