Stem-loop sequence dre-mir-9-7

AccessionMI0001886 (change log)
DescriptionDanio rerio miR-9-7 stem-loop
Gene family MIPF0000014; mir-9
Literature search

22 open access papers mention dre-mir-9-7
(211 sentences)

Stem-loop
       -        -  c       a       g     guua 
5' gggu uaguuuuu cu uuugguu ucuagcu uauga    u
   |||| |||||||| || ||||||| ||||||| |||||    g
3' ucca aucaaaga ga aagccaa agaucga auacu    a
       u        u  -       g       a     auaa 
Get sequence
Deep sequencing
49825 reads, 1.6e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 59102169-59102252 [-]
intergenic
Database links

Mature sequence dre-miR-9-5p

Accession MIMAT0001769
Previous IDsdre-miR-9
Sequence

14 - 

ucuuugguuaucuagcuguauga

 - 36

Get sequence
Deep sequencing220384 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-9-7-3p

Accession MIMAT0031933
Sequence

51 - 

uaaagcuagagaaccgaaagua

 - 72

Get sequence
Deep sequencing18361 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).