Stem-loop sequence dre-mir-10c

AccessionMI0001888
DescriptionDanio rerio miR-10c stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        -    -ua       -   g     c          uaaacag 
5' ccugu cauc   uauauac ccu uagau cggauuugug       a
   ||||| ||||   ||||||| ||| ||||| ||||||||||        
3' ggaua guag   auguaug ggg aucua gcuuaaacac       c
        u    uug       a   g     u          ugacacg 
Get sequence
Deep sequencing
11991 reads, 1.08e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
3: 24011892-24011986 [+]
sense
OTTDART00000024410 ; hoxb3a-001; intron 1
OTTDART00000052973 ; hoxb4a-002; intron 1
ENSDART00000078466 ; hoxb3a-001; intron 1
ENSDART00000151584 ; hoxb4a-002; intron 1
antisense
OTTDART00000052970 ; si:ch73-4e5.1-004; intron 2
OTTDART00000052969 ; si:ch73-4e5.1-002; intron 4
ENSDART00000154772 ; si:ch73-4e5.1-004; intron 2
ENSDART00000157300 ; si:ch73-4e5.1-002; intron 4
Database links

Mature sequence dre-miR-10c-5p

Accession MIMAT0001770
Previous IDsdre-miR-10c
Sequence

16 - 

uacccuguagauccggauuugu

 - 37

Get sequence
Deep sequencing10637 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-10c-3p

Accession MIMAT0031935
Sequence

58 - 

aaauucguaucuaggggagua

 - 78

Get sequence
Deep sequencing496 reads, 3 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).