Stem-loop sequence dre-mir-10d

AccessionMI0001889
Previous IDsdre-mir-10d-1
DescriptionDanio rerio miR-10d stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u      -uu    ---c              a    g           g    uuuaca 
5'  ggaagc   uguu    cgucgucuauauau cccu uagaaccgaau ugug      c
    ||||||   ||||    |||||||||||||| |||| ||||||||||| ||||      a
3'  cuuucg   gcaa    guagcagguauaug gggg auuuuggcuua acac      g
   a      ucu    aaac              a    -           g    uuaaac 
Get sequence
Deep sequencing
3874 reads, 394 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
6: 10777971-10778088 [+]
intergenic
Database links

Mature sequence dre-miR-10d-5p

Accession MIMAT0001771
Previous IDsdre-miR-10d
Sequence

28 - 

uacccuguagaaccgaaugugug

 - 50

Get sequence
Deep sequencing3226 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-10d-3p

Accession MIMAT0003394
Previous IDsdre-miR-10d*
Sequence

68 - 

cagauucgguuuuaggggagua

 - 89

Get sequence
Deep sequencing187 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).