Stem-loop sequence dre-mir-16b

AccessionMI0001895 (change log)
DescriptionDanio rerio miR-16b stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        acuu    g g  a     ------     -        g          -ua          ucaaa  a 
5' ccuga    ggcc u ug cagac      uggcu gccuggcu uagcagcacg   aauauuggag     gc c
   |||||    |||| | || |||||      ||||| |||||||| ||||||||||   ||||||||||     ||  
3' gggcu    ccgg g gc gucug      gccgg cggauuga gucgucgugc   uuaugaccuc     cg u
        ----    - g  -     ccauuu     g        g          cag          cuaag  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 46722379-46722518 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-16b
dre-mir-15a-1chr1: 46722622-46722705 [-]
dre-mir-16bchr1: 46722379-46722518 [-]
Database links

Mature sequence dre-miR-16b

Accession MIMAT0001775
Sequence

39 - 

uagcagcacguaaauauuggag

 - 60

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).