Stem-loop sequence dre-mir-16b

AccessionMI0001895 (change log)
DescriptionDanio rerio miR-16b stem-loop
Gene family MIPF0000006; mir-15
Literature search

10 open access papers mention dre-mir-16b
(17 sentences)

Stem-loop
        acuu    g g  a     ------     -        g          -ua          ucaaa  a 
5' ccuga    ggcc u ug cagac      uggcu gccuggcu uagcagcacg   aauauuggag     gc c
   |||||    |||| | || |||||      ||||| |||||||| ||||||||||   ||||||||||     ||  
3' gggcu    ccgg g gc gucug      gccgg cggauuga gucgucgugc   uuaugaccuc     cg u
        ----    - g  -     ccauuu     g        g          cag          cuaag  u 
Get sequence
Deep sequencing
24273 reads, 1.52e+03 reads per million, 11 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 46722379-46722518 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-16b
dre-mir-15a-1chr1: 46722622-46722705 [-]
dre-mir-16bchr1: 46722379-46722518 [-]
Database links

Mature sequence dre-miR-16b

Accession MIMAT0001775
Sequence

39 - 

uagcagcacguaaauauuggag

 - 60

Get sequence
Deep sequencing24207 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).