Stem-loop sequence dre-mir-16c

AccessionMI0001896
DescriptionDanio rerio miR-16c stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       u  -           -  ---   uug                  -ua         guuacuccuu   c 
5' gagg ug ugugugugugc gu   gug   ucuugcuuuagcagcaug   aauauugga          ggc a
   |||| || ||||||||||| ||   |||   ||||||||||||||||||   |||||||||          |||  
3' uucc ac gcacguacacg cg   cac   agaacgaagucgucgugc   uuauaaccu          ccg a
       u  u           a  aac   uga                  ucg         ----------   u 
Get sequence
Deep sequencing
7578 reads, 1.71e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
9: 30685660-30685795 [-]
sense
OTTDART00000059692 ; si:ch211-261i19.3-002; exon 2
OTTDART00000059691 ; si:ch211-261i19.3-001; exon 3
ENSDART00000156609 ; si:ch211-261i19.3-002; exon 2
ENSDART00000154709 ; si:ch211-261i19.3-001; exon 3
antisense
OTTDART00000059690 ; trim13-002; intron 2
ENSDART00000157265 ; trim13-002; intron 2
Clustered miRNAs
< 10kb from dre-mir-16c
dre-mir-15a-29: 30685819-30685920 [-]
dre-mir-16c9: 30685660-30685795 [-]
Database links

Mature sequence dre-miR-16c-5p

Accession MIMAT0001776
Previous IDsdre-miR-16c
Sequence

35 - 

uagcagcauguaaauauuggag

 - 56

Get sequence
Deep sequencing6493 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-16c-3p

Accession MIMAT0031937
Sequence

76 - 

uccaauauugcucgugcugcuga

 - 98

Get sequence
Deep sequencing238 reads, 4 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).