Stem-loop sequence dre-mir-16c

AccessionMI0001896 (change log)
DescriptionDanio rerio miR-16c stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       u  -           -  ---   uug                  -ua         guuacuccuu   c 
5' gagg ug ugugugugugc gu   gug   ucuugcuuuagcagcaug   aauauugga          ggc a
   |||| || ||||||||||| ||   |||   ||||||||||||||||||   |||||||||          |||  
3' uucc ac gcacguacacg cg   cac   agaacgaagucgucgugc   uuauaaccu          ccg a
       u  u           a  aac   uga                  ucg         ----------   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 29652352-29652487 [-]
sense
OTTDART00000059692 ; si:ch211-261i19.3-002; exon 2
OTTDART00000059691 ; si:ch211-261i19.3-001; exon 3
ENSDART00000156609 ; si:ch211-261i19.3-002; exon 2
ENSDART00000154709 ; si:ch211-261i19.3-001; exon 3
antisense
OTTDART00000059690 ; trim13-002; intron 2
ENSDART00000157265 ; trim13-002; intron 2
KZ114910.1: 16404-16539 [-]
sense
OTTDART00000059692 ; si:ch211-261i19.3-002; exon 2
OTTDART00000059691 ; si:ch211-261i19.3-001; exon 3
ENSDART00000156609 ; si:ch211-261i19.3-002; exon 2
ENSDART00000154709 ; si:ch211-261i19.3-001; exon 3
antisense
OTTDART00000059690 ; trim13-002; intron 2
ENSDART00000157265 ; trim13-002; intron 2
Clustered miRNAs
< 10kb from dre-mir-16c
dre-mir-15a-2chr9: 29652511-29652612 [-]
dre-mir-16cchr9: 29652352-29652487 [-]
Database links

Mature sequence dre-miR-16c-5p

Accession MIMAT0001776
Previous IDsdre-miR-16c
Sequence

35 - 

uagcagcauguaaauauuggag

 - 56

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-16c-3p

Accession MIMAT0031937
Sequence

76 - 

uccaauauugcucgugcugcuga

 - 98

Get sequence
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).