Dre-mir-20b is a type of microRNA that has been studied in relation to embryo development and retinal morphology [PMC6834413]. In a study, it was found that in the 4 uM dre-mir-20b group, the embryo mortality rate was significantly higher and the survival rate was significantly reduced compared to the NC group and wild type group (Table 1) [PMC6834413]. Additionally, the mRNA expressions of FGF2 and GRB2 were significantly lower in the dre-mir-20b group compared to the NC group and wild-type group (Figure 9B) [PMC6834413]. Abnormal retinal morphology was observed in the dre-mir-20b group, characterized by sparse and irregular photoreceptor cells [PMC6834413'>PMC6834413'>PMC6834413'>PMC6834413]. Furthermore, there were more overall morphological abnormalities, particularly a significant reduction in eye volume in the 4 uM dre-mir-20b group (Figure 9A) [PMC6834413]. Immunofluorescence tests showed that FGF2 and GRB2 were expressed in the photoreceptor cell layer, but their expression levels were decreased in the dre-mir-20b group compared to the NC group and wild type group (Figure 10B, 10C) [PMC6834413]. The study used 4 uM dre-mir-20b mimics and corresponding negative control (NC) injected at single cell stage [PMC6834413]. These findings suggest that dre-mir-20b plays a role in embryo development, retinal morphology, and gene expression regulation [PMC6834413].
gaguu u -ucCA UC G G ug a ugucc ggcagu AAGUGC ACA UGCAG UAG cc ||||| |||||| |||||| ||| ||||| ||| || g gcagg ccguua UUCACG UGU ACGUC Auc gg cuucc - UGAAC UC A - ua u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0001778 |
Description | Danio rerio dre-miR-20b-5p mature miRNA |
Sequence | 20 - CAAAGUGCUCACAGUGCAGGUAG - 42 |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
Accession | MIMAT0031939 |
Description | Danio rerio dre-miR-20b-3p mature miRNA |
Sequence | 56 - ACUGCAAUGUCUGCACUUCAAGU - 78 |
Evidence | not_experimental |
Database links |
|