Accession
MI0001899
Description
Danio rerio
dre-mir-20b precursor miRNA
Gene family
MIPF0000001;
mir-17
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Dre-mir-20b is a type of microRNA that has been studied in relation to embryo development and retinal morphology [PMC6834413]. In a study, it was found that in the 4 uM dre-mir-20b group, the embryo mortality rate was significantly higher and the survival rate was significantly reduced compared to the NC group and wild type group (Table 1) [PMC6834413]. Additionally, the mRNA expressions of FGF2 and GRB2 were significantly lower in the dre-mir-20b group compared to the NC group and wild-type group (Figure 9B) [PMC6834413]. Abnormal retinal morphology was observed in the dre-mir-20b group, characterized by sparse and irregular photoreceptor cells [PMC6834413'>PMC6834413'>PMC6834413'>PMC6834413]. Furthermore, there were more overall morphological abnormalities, particularly a significant reduction in eye volume in the 4 uM dre-mir-20b group (Figure 9A) [PMC6834413]. Immunofluorescence tests showed that FGF2 and GRB2 were expressed in the photoreceptor cell layer, but their expression levels were decreased in the dre-mir-20b group compared to the NC group and wild type group (Figure 10B, 10C) [PMC6834413]. The study used 4 uM dre-mir-20b mimics and corresponding negative control (NC) injected at single cell stage [PMC6834413]. These findings suggest that dre-mir-20b plays a role in embryo development, retinal morphology, and gene expression regulation [PMC6834413].
Literature search
2 open access papers mention dre-mir-20b
(5 sentences)
(5 sentences)
Sequence
19700
reads,
922
reads per million, 10 experiments
gaguuuguccuggcaguucCAAAGUGCUCACAGUGCAGGUAGugccaguggaucuACUGCAAUGUCUGCACUUCAAGUauugccggacgccuuc
.....(((((.((((((....((((((..(((.(((((.(((..((...))..)))))))).)))..)))))).....))))))))))).....
.....(((((.((((((....((((((..(((.(((((.(((..((...))..)))))))).)))..)))))).....))))))))))).....
Structure
gaguu u -ucCA UC G G ug a
ugucc ggcagu AAGUGC ACA UGCAG UAG cc
||||| |||||| |||||| ||| ||||| ||| || g
gcagg ccguua UUCACG UGU ACGUC Auc gg
cuucc - UGAAC UC A - ua u
Annotation confidence
High
Do you think this miRNA is real?
Genome context
chr14: 31467167-31467260 [-]
Clustered miRNAs
3 other miRNAs are < 10 kb from dre-mir-20b
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Database links
Mature dre-miR-20b-5p
| Accession | MIMAT0001778 |
| Description | Danio rerio dre-miR-20b-5p mature miRNA |
| Sequence | 20 - CAAAGUGCUCACAGUGCAGGUAG - 42 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
Mature dre-miR-20b-3p
| Accession | MIMAT0031939 |
| Description | Danio rerio dre-miR-20b-3p mature miRNA |
| Sequence | 56 - ACUGCAAUGUCUGCACUUCAAGU - 78 |
| Evidence | not_experimental |
| Database links |
|
References
|
