Stem-loop sequence dre-mir-18b

AccessionMI0001901
DescriptionDanio rerio miR-18b stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20a/b, miR-93, and miR-106a/b. With the exception of miR-93, these microRNAs are produced from several microRNA gene clusters, which apparently arose from a series of ancient evolutionary genetic duplication events, and also include members of the miR-19, and miR-25 families. These clusters are transcribed as long non-coding RNA transcripts that are processed to form ~70 nucleotide microRNA precursors, that are subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. The mature microRNA products are thought to regulate expression levels of other genes through complementarity to the 3' UTR of specific target messenger RNA. The paralogous miRNA gene clusters that give rise to miR-17 family microRNAs (miR-17~92, miR-106a~363, and miR-106b~25) have been implicated in a wide variety of malignancies and are sometimes referred to as oncomirs. The oncogenic potential of these non-protein encoding genes was first identified in mouse viral tumorigenesis screens. In humans, the activating mutations of miR-17~92 have been identified in non-Hodgkin's lymphoma, whereas the miRNA constituents of the clusters are overexpressed in a multiple cancer types. High level expression of miR-17 family members induces cell proliferation, whereas deletion of the miR-17~92 cluster, in mice, is lethal and causes lung and lymphoid cell developmental defects.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ua  g         --   u        u    a   -  aaau 
5'   cu cuuaugcua  agg gcauuuag gcag uag ug    a
     || |||||||||  ||| |||||||| |||| ||| ||    g
3'   gg gaauacggu  ucc cgugaauc cguc auc ac    a
   uc  g         cu   c        c    -   c  gauc 
Get sequence
Deep sequencing
1341 reads, 217 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
9: 55420763-55420849 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-18b
dre-mir-17a-29: 55420876-55420958 [-]
dre-mir-18b9: 55420763-55420849 [-]
dre-mir-92a-29: 55420212-55420306 [-]
Database links

Mature sequence dre-miR-18b-5p

Accession MIMAT0001780
Previous IDsdre-miR-18b
Sequence

13 - 

uaaggugcauuuagugcagaua

 - 34

Get sequence
Deep sequencing1123 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-18b-3p

Accession MIMAT0003397
Previous IDsdre-miR-18b*
Sequence

55 - 

cugcccuaagugccccuucugg

 - 76

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).