Stem-loop sequence dre-mir-19a

AccessionMI0001903
DescriptionDanio rerio miR-19a stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There are 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uggu    uu u  gc             --      uacaagaa   g 
5'     gcag  c cu  uaguuuugcauag  uugcac        aac g
       ||||  | ||  |||||||||||||  ||||||        |||  
3'     cguc  g gg  gucaaaacguauc  aacgug        uug g
   -cgu    cg u  ua             ua      --------   a 
Get sequence
Deep sequencing
5625 reads, 1.28e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
1: 2806384-2806472 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-19a
dre-mir-17a-11: 2806071-2806208 [+]
dre-mir-18a1: 2806232-2806314 [+]
dre-mir-19a1: 2806384-2806472 [+]
dre-mir-20a1: 2806565-2806717 [+]
dre-mir-19b1: 2806750-2806836 [+]
dre-mir-92a-11: 2806869-2806953 [+]
Database links

Mature sequence dre-miR-19a-5p

Accession MIMAT0003398
Previous IDsdre-miR-19a*
Sequence

16 - 

cuaguuuugcauaguugcacua

 - 37

Get sequence
Deep sequencing154 reads, 3 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-19a-3p

Accession MIMAT0001782
Previous IDsdre-miR-19a
Sequence

53 - 

ugugcaaaucuaugcaaaacuga

 - 75

Get sequence
Deep sequencing4951 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).