Stem-loop sequence dre-mir-19b

AccessionMI0001904
DescriptionDanio rerio miR-19b stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There are 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       gac  c             -   -       uca  uuuua 
5' gcug   cc cggucaguuuugc ugg uuugcau   gc     a
   ||||   || ||||||||||||| ||| |||||||   ||      
3' cgac   gg guuagucaaaacg acc aaacgug   cg     g
       ---  u             u   u       ucg  uguca 
Get sequence
Deep sequencing
20648 reads, 4.08e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
1: 2806750-2806836 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-19b
dre-mir-17a-11: 2806071-2806208 [+]
dre-mir-18a1: 2806232-2806314 [+]
dre-mir-19a1: 2806384-2806472 [+]
dre-mir-20a1: 2806565-2806717 [+]
dre-mir-19b1: 2806750-2806836 [+]
dre-mir-92a-11: 2806869-2806953 [+]
Database links

Mature sequence dre-miR-19b-5p

Accession MIMAT0003399
Previous IDsdre-miR-19b*
Sequence

16 - 

aguuuugcugguuugcauucag

 - 37

Get sequence
Deep sequencing139 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-19b-3p

Accession MIMAT0001783
Previous IDsdre-miR-19b
Sequence

55 - 

ugugcaaauccaugcaaaacuga

 - 77

Get sequence
Deep sequencing17872 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).