Stem-loop sequence dre-mir-19b

AccessionMI0001904 (change log)
DescriptionDanio rerio miR-19b stem-loop
Gene family MIPF0000011; mir-19
Literature search

5 open access papers mention dre-mir-19b
(96 sentences)

Stem-loop
       gac  c             -   -       uca  uuuua 
5' gcug   cc cggucaguuuugc ugg uuugcau   gc     a
   ||||   || ||||||||||||| ||| |||||||   ||      
3' cgac   gg guuagucaaaacg acc aaacgug   cg     g
       ---  u             u   u       ucg  uguca 
Get sequence
Deep sequencing
58204 reads, 2.72e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 3297484-3297570 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-19b
dre-mir-17a-1chr1: 3298112-3298249 [-]
dre-mir-18achr1: 3298006-3298088 [-]
dre-mir-19achr1: 3297848-3297936 [-]
dre-mir-20achr1: 3297603-3297755 [-]
dre-mir-19bchr1: 3297484-3297570 [-]
dre-mir-92a-1chr1: 3297367-3297451 [-]
Database links

Mature sequence dre-miR-19b-5p

Accession MIMAT0003399
Previous IDsdre-miR-19b*
Sequence

16 - 

aguuuugcugguuugcauucag

 - 37

Get sequence
Deep sequencing1073 reads, 11 experiments
Evidence experimental; cloned [1]
Database links

Mature sequence dre-miR-19b-3p

Accession MIMAT0001783
Previous IDsdre-miR-19b
Sequence

55 - 

ugugcaaauccaugcaaaacuga

 - 77

Get sequence
Deep sequencing57095 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).