Stem-loop sequence dre-mir-19c

AccessionMI0001905 (change log)
DescriptionDanio rerio miR-19c stem-loop
Gene family MIPF0000011; mir-19
Literature search

4 open access papers mention dre-mir-19c
(30 sentences)

Stem-loop
   u  aaaag     uuauc  g             -     -   uc    uuuau 
5'  gg     cccug     ug ggugaguuuugca ggauu gca  cggc     u
    ||     |||||     || ||||||||||||| ||||| |||  ||||     a
3'  cc     gggac     gc ucgcucaaaacgu ccuaa cgu  gucg     c
   a  aaaca     ----c  g             a     a   --    uacaa 
Get sequence
Deep sequencing
49158 reads, 2.21e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 31467026-31467130 [-]
intergenic
KZ115452.1: 23130-23234 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-19c
dre-mir-18cchr14: 31467376-31467460 [-]
dre-mir-20bchr14: 31467167-31467260 [-]
dre-mir-19cchr14: 31467026-31467130 [-]
dre-mir-363chr14: 31466671-31466797 [-]
Database links

Mature sequence dre-miR-19c-5p

Accession MIMAT0031940
Sequence

26 - 

aguuuugcaggauugcauccgg

 - 47

Get sequence
Deep sequencing268 reads, 3 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-19c-3p

Accession MIMAT0001784
Previous IDsdre-miR-19c
Sequence

64 - 

ugugcaaauccaugcaaaacucg

 - 86

Get sequence
Deep sequencing48890 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).