Stem-loop sequence dre-mir-19c

AccessionMI0001905
DescriptionDanio rerio miR-19c stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There are 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u  aaaag     uuauc  g             -     -   uc    uuuau 
5'  gg     cccug     ug ggugaguuuugca ggauu gca  cggc     u
    ||     |||||     || ||||||||||||| ||||| |||  ||||     a
3'  cc     gggac     gc ucgcucaaaacgu ccuaa cgu  gucg     c
   a  aaaca     ----c  g             a     a   --    uacaa 
Get sequence
Deep sequencing
24480 reads, 2.21e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
14: 32336905-32337009 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-19c
dre-mir-18c14: 32337255-32337339 [-]
dre-mir-20b14: 32337046-32337139 [-]
dre-mir-19c14: 32336905-32337009 [-]
dre-mir-36314: 32336550-32336676 [-]
Database links

Mature sequence dre-miR-19c-5p

Accession MIMAT0031940
Sequence

26 - 

aguuuugcaggauugcauccgg

 - 47

Get sequence
Deep sequencing213 reads, 2 experiments
Evidence not experimental

Mature sequence dre-miR-19c-3p

Accession MIMAT0001784
Previous IDsdre-miR-19c
Sequence

64 - 

ugugcaaauccaugcaaaacucg

 - 86

Get sequence
Deep sequencing22104 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).