Stem-loop sequence dre-mir-19d

AccessionMI0001906
DescriptionDanio rerio miR-19d stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There are 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   guu   ug   g    c      -    gg   gu    cu  g 
5'    gug  gcg ucag uuugcg gggu  gca  cagc  cc u
      |||  ||| |||| |||||| ||||  |||  ||||  ||  
3'    cgc  cgc aguc aaacgu ccca  cgu  gucg  gg g
   cau   gu   g    a      a    aa   --    cc  u 
Get sequence
Deep sequencing
5098 reads, 797 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
14: 205464-205550 [-]
sense
ENSDART00000051890 ; mcm7-201; intron 13
Clustered miRNAs
< 10kb from dre-mir-19d
dre-mir-9314: 205635-205708 [-]
dre-mir-19d14: 205464-205550 [-]
dre-mir-2514: 205362-205443 [-]
Database links

Mature sequence dre-miR-19d-5p

Accession MIMAT0031941
Sequence

15 - 

agcuuugcggggugggcagucagc

 - 38

Get sequence
Deep sequencing245 reads, 3 experiments
Evidence not experimental

Mature sequence dre-miR-19d-3p

Accession MIMAT0001785
Previous IDsdre-miR-19d
Sequence

53 - 

ugugcaaacccaugcaaaacuga

 - 75

Get sequence
Deep sequencing3550 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).