Stem-loop sequence dre-mir-19d

AccessionMI0001906 (change log)
DescriptionDanio rerio miR-19d stem-loop
Gene family MIPF0000011; mir-19
Literature search

4 open access papers mention dre-mir-19d
(28 sentences)

Stem-loop
   guu    ga  g    c      -    gg   gu    cu  g 
5'    gugu  cg ucag uuugcg gggu  gca  cagc  cc u
      ||||  || |||| |||||| ||||  |||  ||||  ||  
3'    cgcg  gc aguc aaacgu ccca  cgu  gucg  gg g
   cau    uc  g    a      a    aa   --    cc  u 
Get sequence
Deep sequencing
27926 reads, 1.65e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 100660-100746 [+]
sense
ENSDART00000051890 ; mcm7-201; intron 13
Clustered miRNAs
< 10kb from dre-mir-19d
dre-mir-93chr14: 100502-100575 [+]
dre-mir-19dchr14: 100660-100746 [+]
dre-mir-25chr14: 100767-100848 [+]
Database links

Mature sequence dre-miR-19d-5p

Accession MIMAT0031941
Sequence

15 - 

agcuuugcggggugggcagucagc

 - 38

Get sequence
Deep sequencing307 reads, 8 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-19d-3p

Accession MIMAT0001785
Previous IDsdre-miR-19d
Sequence

53 - 

ugugcaaacccaugcaaaacuga

 - 75

Get sequence
Deep sequencing27618 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).