Stem-loop sequence dre-mir-21-1

AccessionMI0001908
DescriptionDanio rerio miR-21-1 stem-loop
Gene family MIPF0000060; mir-21
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MIRN21. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

microRNA 21 also known as hsa-mir-21 or miRNA21 is a mammalian microRNA that is encoded by the MIR21 gene. MIRN21 was one of the first mammalian microRNAs identified. The mature miR-21 sequence is strongly conserved throughout evolution. The human microRNA-21 gene is located on plus strand of chromosome 17q23.2 (55273409–55273480) within a coding gene TMEM49 (also called vacuole membrane protein). Despite being located in intronic regions of a coding gene in the direction of transcription, it has its own promoter regions and forms a ~3433-nt long primary transcript of miR-21 (known as pri-miR-21) which is independently transcribed. The stem–loop recursor of miR-21(pre-miR-21) resides between nucleotides 2445 and 2516 of pri-miR-21.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         gucuuu     c u   uau    cuuu     u               u       g     g   uuac 
5' uuaugu      auugg g gga   aagu    cccag gugucagauagcuua cagacug uguug cug    a
   ||||||      ||||| | |||   ||||    ||||| ||||||||||||||| ||||||| ||||| |||    u
3' aguaua      uagcc c ucu   uuua    ggguu uacagucugucggau gucugac acagc ggc    u
         -aaaau     u u   ---    ---c     u               -       a     -   ccgc 
Get sequence
Deep sequencing
54347 reads, 3.41e+04 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
10: 28880675-28880822 [-]
intergenic
Database links

Mature sequence dre-miR-21

Accession MIMAT0001787
Sequence

49 - 

uagcuuaucagacugguguuggc

 - 71

Get sequence
Deep sequencing49440 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).