Stem-loop sequence dre-mir-22a

AccessionMI0001910
Previous IDsdre-mir-22a-1
DescriptionDanio rerio miR-22a stem-loop
Gene family MIPF0000053; mir-22
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-22. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-22 microRNA is a short RNA molecule. MicroRNAs are an abundant class of molecules, approximately 22 nucleotides in length, which can post-transcriptionally regulate gene expression by binding to the 3’ UTR of mRNAs expressed in a cell.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ug   u              -      a      u  ccuug 
5' gc  acc gcagcaguucuuca cuggca gcuuua gu     u
   ||  ||| |||||||||||||| |||||| |||||| ||      
3' cg  ugg uguugucaagaagu gaccgu cgaaau cg     g
     gu   -              c      -      -  accau 
Get sequence
Deep sequencing
88504 reads, 2.35e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
15: 24261942-24262027 [-]
intergenic
Database links

Mature sequence dre-miR-22a-5p

Accession MIMAT0031942
Sequence

14 - 

aguucuucacuggcaagcuuua

 - 35

Get sequence
Deep sequencing1551 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-22a-3p

Accession MIMAT0001788
Previous IDsdre-miR-22a
Sequence

55 - 

aagcugccagcugaagaacugu

 - 76

Get sequence
Deep sequencing77175 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).