Stem-loop sequence dre-mir-22a

AccessionMI0001910 (change log)
Previous IDsdre-mir-22a-1
DescriptionDanio rerio miR-22a stem-loop
Gene family MIPF0000053; mir-22
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-22. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-22 microRNA is a short RNA molecule. MicroRNAs are an abundant class of molecules, approximately 22 nucleotides in length, which can post-transcriptionally regulate gene expression by binding to the 3’ UTR of mRNAs expressed in a cell.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ug   u              -      a      u  ccuug 
5' gc  acc gcagcaguucuuca cuggca gcuuua gu     u
   ||  ||| |||||||||||||| |||||| |||||| ||      
3' cg  ugg uguugucaagaagu gaccgu cgaaau cg     g
     gu   -              c      -      -  accau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr15: 24908394-24908479 [-]
intergenic
KZ114948.1: 258114-258199 [-]
intergenic
Database links

Mature sequence dre-miR-22a-5p

Accession MIMAT0031942
Sequence

14 - 

aguucuucacuggcaagcuuua

 - 35

Get sequence
Evidence not experimental
Database links

Mature sequence dre-miR-22a-3p

Accession MIMAT0001788
Previous IDsdre-miR-22a
Sequence

55 - 

aagcugccagcugaagaacugu

 - 76

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).