Stem-loop sequence dre-mir-22b

AccessionMI0001912
DescriptionDanio rerio miR-22b stem-loop
Gene family MIPF0000053; mir-22
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-22. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-22 microRNA is a short RNA molecule. MicroRNAs are an abundant class of molecules, approximately 22 nucleotides in length, which can post-transcriptionally regulate gene expression by binding to the 3’ UTR of mRNAs expressed in a cell.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         u     uc        -     u       -u   g 
5' guuacu cacag  guucuuca cuggc agcuuua  gug c
   |||||| |||||  |||||||| ||||| |||||||  |||  
3' caaugg guguu  cgagaagu gaccg ucgaaau  cac a
         -     gu        u     -       uc   g 
Get sequence
Deep sequencing
2145 reads, 566 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
5: 13813148-13813229 [+]
sense
OTTDART00000030000 ; si:dkey-98f17.5-001; intron 4
ENSDART00000133167 ; si:dkey-98f17.5-001; intron 4
Database links

Mature sequence dre-miR-22b-5p

Accession MIMAT0031943
Sequence

14 - 

cguucuucacuggcuagcuuua

 - 35

Get sequence
Deep sequencing60 reads, 3 experiments
Evidence not experimental

Mature sequence dre-miR-22b-3p

Accession MIMAT0001789
Previous IDsdre-miR-22b
Sequence

51 - 

aagcugccaguugaagagcugu

 - 72

Get sequence
Deep sequencing1750 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).