Stem-loop sequence dre-mir-22b

AccessionMI0001912 (change log)
DescriptionDanio rerio miR-22b stem-loop
Gene family MIPF0000053; mir-22
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-22. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-22 microRNA is a short RNA molecule. MicroRNAs are an abundant class of molecules, approximately 22 nucleotides in length, which can post-transcriptionally regulate gene expression by binding to the 3’ UTR of mRNAs expressed in a cell.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         u     uc        -     u       -u   g 
5' guuacu cacag  guucuuca cuggc agcuuua  gug c
   |||||| |||||  |||||||| ||||| |||||||  |||  
3' caaugg guguu  cgagaagu gaccg ucgaaau  cac a
         -     gu        u     -       uc   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 12610802-12610883 [+]
sense
OTTDART00000030000 ; si:dkey-98f17.5-001; intron 4
ENSDART00000133167 ; si:dkey-98f17.5-001; intron 4
KZ115105.1: 46708-46789 [+]
sense
OTTDART00000030000 ; si:dkey-98f17.5-001; intron 4
ENSDART00000133167 ; si:dkey-98f17.5-001; intron 4
Database links

Mature sequence dre-miR-22b-5p

Accession MIMAT0031943
Sequence

14 - 

cguucuucacuggcuagcuuua

 - 35

Get sequence
Evidence not experimental
Database links

Mature sequence dre-miR-22b-3p

Accession MIMAT0001789
Previous IDsdre-miR-22b
Sequence

51 - 

aagcugccaguugaagagcugu

 - 72

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).