Stem-loop sequence dre-mir-23a-1

AccessionMI0001913 (change log)
DescriptionDanio rerio miR-23a-1 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
         g    - a  --          cc       gguggauaaa  g 
5' gcugug cggg g gg  guuccuggca  gugauuu          ca a
   |||||| |||| | ||  ||||||||||  |||||||          ||  
3' uggcac gucc c cc  uagggaccgu  cacuaaa          gu a
         -    u a  uu          ua       ---------a  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr22: 5293213-5293301 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-23a-1
dre-mir-23a-1chr22: 5293213-5293301 [+]
dre-mir-27echr22: 5299951-5300056 [+]
Database links

Mature sequence dre-miR-23a-3p

Accession MIMAT0001790
Previous IDsdre-miR-23a
Sequence

56 - 

aucacauugccagggauuucca

 - 77

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).