Stem-loop sequence dre-mir-23a-2

AccessionMI0001915 (change log)
Previous IDsdre-mir-23a-3
DescriptionDanio rerio miR-23a-2 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
       ---  -   c     -g               a       uuaaac 
5' cucu   uc ugc ggcca  gggaauuccuggcag gugauuu      c
   ||||   || ||| |||||  ||||||||||||||| |||||||      u
3' gaga   ag gug ucggu  ccuuuagggaccguu cacuaag      a
       cuc  u   c     aa               a       ucagua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 13406226-13406323 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-23a-2
dre-mir-23a-2chr3: 13406226-13406323 [+]
dre-mir-27cchr3: 13406451-13406538 [+]
dre-mir-24-2chr3: 13412979-13413060 [+]
Database links

Mature sequence dre-miR-23a-5p

Accession MIMAT0031944
Sequence

19 - 

gaauuccuggcagagugauuu

 - 39

Get sequence
Evidence not experimental

Mature sequence dre-miR-23a-3p

Accession MIMAT0001790
Previous IDsdre-miR-23a
Sequence

57 - 

aucacauugccagggauuucca

 - 78

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).