Stem-loop sequence dre-mir-23a-2

AccessionMI0001915
Previous IDsdre-mir-23a-3
DescriptionDanio rerio miR-23a-2 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
       ---  -   c     -g               a       uuaaac 
5' cucu   uc ugc ggcca  gggaauuccuggcag gugauuu      c
   ||||   || ||| |||||  ||||||||||||||| |||||||      u
3' gaga   ag gug ucggu  ccuuuagggaccguu cacuaag      a
       cuc  u   c     aa               a       ucagua 
Get sequence
Deep sequencing
1095 reads, 694 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
3: 13208734-13208831 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-23a-2
dre-mir-23a-23: 13208734-13208831 [+]
dre-mir-27c-13: 13208959-13209046 [+]
dre-mir-24-23: 13215487-13215568 [+]
Database links

Mature sequence dre-miR-23a-5p

Accession MIMAT0031944
Sequence

19 - 

gaauuccuggcagagugauuu

 - 39

Get sequence
Deep sequencing395 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-23a-3p

Accession MIMAT0001790
Previous IDsdre-miR-23a
Sequence

57 - 

aucacauugccagggauuucca

 - 78

Get sequence
Deep sequencing11884 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).