Stem-loop sequence dre-mir-23a-3

AccessionMI0001916
Previous IDsdre-mir-23a-4
DescriptionDanio rerio miR-23a-3 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   c       --a gg           a       -gg     
5'  cagcugg   g  auuccuggcag gugauuu   gauu 
    |||||||   |  ||||||||||| |||||||   ||| a
3'  gucgacc   c  uagggaccguu cacuaaa   cuau 
   u       aac uu           a       aua     
Get sequence
Deep sequencing
10170 reads, 5.87e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
2: 33618310-33618387 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-23a-3
dre-mir-23a-32: 33618310-33618387 [+]
dre-mir-27a2: 33620200-33620330 [+]
Database links

Mature sequence dre-miR-23a-3-5p

Accession MIMAT0031945
Sequence

11 - 

ggauuccuggcagagugauuu

 - 31

Get sequence
Deep sequencing589 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-23a-3p

Accession MIMAT0001790
Previous IDsdre-miR-23a
Sequence

48 - 

aucacauugccagggauuucca

 - 69

Get sequence
Deep sequencing11884 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).