Stem-loop sequence dre-mir-23a-3

AccessionMI0001916 (change log)
Previous IDsdre-mir-23a-4
DescriptionDanio rerio miR-23a-3 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   c       --a gg           a       -gg     
5'  cagcugg   g  auuccuggcag gugauuu   gauu 
    |||||||   |  ||||||||||| |||||||   ||| a
3'  gucgacc   c  uagggaccguu cacuaaa   cuau 
   u       aac uu           a       aua     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 33900435-33900512 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-23a-3
dre-mir-23a-3chr2: 33900435-33900512 [+]
dre-mir-27achr2: 33902325-33902455 [+]
dre-mir-24bchr2: 33905762-33905845 [+]
Database links

Mature sequence dre-miR-23a-3-5p

Accession MIMAT0031945
Sequence

11 - 

ggauuccuggcagagugauuu

 - 31

Get sequence
Evidence not experimental
Database links

Mature sequence dre-miR-23a-3p

Accession MIMAT0001790
Previous IDsdre-miR-23a
Sequence

48 - 

aucacauugccagggauuucca

 - 69

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).