Stem-loop sequence dre-mir-24-4

AccessionMI0001918
DescriptionDanio rerio miR-24-4 stem-loop
Gene family MIPF0000041; mir-24
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-24_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-24 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR-24 is conserved in various species, and is clustered with miR-23 and miR-27, on human chromosome 9 and 19. Recently, miR-24 has been shown to suppress expression of two crucial cell cycle control genes, E2F2 and Myc in hematopoietic differentiation and also to promote keratinocyte differentiation by repressing actin-cytoskeleton regulators PAK4, Tsk5 and ArhGAP19.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
          gu  c       g      a      ua       guu 
5' gagggcu  uc cacuugu ccugcu aacugg  ucaguau   g
   |||||||  || ||||||| |||||| ||||||  |||||||   a
3' cuccuga  ag guggaca ggacga uugacu  ggucgug   u
          --  u       a      c      -c       auu 
Get sequence
Deep sequencing
977 reads, 296 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
22: 5011864-5011953 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-24-4
dre-mir-27e22: 5004330-5004435 [+]
dre-mir-24-422: 5011864-5011953 [+]
Database links

Mature sequence dre-miR-24

Accession MIMAT0001792
Sequence

56 - 

uggcucaguucagcaggaacag

 - 77

Get sequence
Deep sequencing10771 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).