Stem-loop sequence dre-mir-25

AccessionMI0001922
DescriptionDanio rerio miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
       g     ag    g     uu g    c    g  au 
5' gccg cgcug  aggc gagac  g gcag ugcc uc  u
   |||| |||||  |||| |||||  | |||| |||| ||  c
3' cggc gugac  ucug cucug  c cguu acgg ag  c
       g     ag    g     uu a    -    a  ac 
Get sequence
Deep sequencing
6290 reads, 912 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
14: 205362-205443 [-]
sense
ENSDART00000051890 ; mcm7-201; intron 13
Clustered miRNAs
< 10kb from dre-mir-25
dre-mir-9314: 205635-205708 [-]
dre-mir-19d14: 205464-205550 [-]
dre-mir-2514: 205362-205443 [-]
Database links

Mature sequence dre-miR-25-5p

Accession MIMAT0031946
Sequence

13 - 

aggcggagacuugggcagcugcc

 - 35

Get sequence
Deep sequencing257 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-25-3p

Accession MIMAT0001793
Previous IDsdre-miR-25
Sequence

51 - 

cauugcacuugucucggucuga

 - 72

Get sequence
Deep sequencing5069 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).