Stem-loop sequence dre-mir-25

AccessionMI0001922 (change log)
DescriptionDanio rerio miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
       g     ag    g     uu g    c    g  au 
5' gccg cgcug  aggc gagac  g gcag ugcc uc  u
   |||| |||||  |||| |||||  | |||| |||| ||  c
3' cggc gugac  ucug cucug  c cguu acgg ag  c
       g     ag    g     uu a    -    a  ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 100767-100848 [+]
sense
ENSDART00000051890 ; mcm7-201; intron 13
Clustered miRNAs
< 10kb from dre-mir-25
dre-mir-93chr14: 100502-100575 [+]
dre-mir-19dchr14: 100660-100746 [+]
dre-mir-25chr14: 100767-100848 [+]
Database links

Mature sequence dre-miR-25-5p

Accession MIMAT0031946
Sequence

13 - 

aggcggagacuugggcagcugcc

 - 35

Get sequence
Evidence not experimental
Database links

Mature sequence dre-miR-25-3p

Accession MIMAT0001793
Previous IDsdre-miR-25
Sequence

51 - 

cauugcacuugucucggucuga

 - 72

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).