Stem-loop sequence dre-mir-26a-1

AccessionMI0001923 (change log)
DescriptionDanio rerio miR-26a-1 stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uuugg     uu     a    a          -g  a 
5'      ccugg  caagu aucc ggauaggcuu  ug u
        |||||  ||||| |||| ||||||||||  || g
3'      ggacu  guuca uagg cuuauccgaa  gc u
   aguaa     ug     g    g          ag  c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 41733533-41733610 [+]
sense
OTTDART00000027578 ; ctdsp1-001; intron 4
ENSDART00000100226 ; ctdsp1-001; intron 4
Database links

Mature sequence dre-miR-26a-5p

Accession MIMAT0001794
Previous IDsdre-miR-26a
Sequence

11 - 

uucaaguaauccaggauaggcu

 - 32

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-26a-3p

Accession MIMAT0031947
Sequence

49 - 

ccuauucgggaugacuugguuc

 - 70

Get sequence
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).