Stem-loop sequence dre-mir-26a-2

AccessionMI0001925 (change log)
Previous IDsdre-mir-26a-3
DescriptionDanio rerio miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   guguggacu     g   -    -----       uc   u  u         ca         gu ug 
5'          ugagu cug gaag     ugguugu  ccu gu caaguaauc  ggauaggcu  c  u
            ||||| ||| ||||     |||||||  ||| || |||||||||  |||||||||  |   
3'          acuca ggu cuuc     gccgacg  gga ca guucauuag  cuuauccgg  g  c
   ------cgu     a   a    ccguu       gu   u  c         ua         ag uc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 21375467-21375594 [+]
sense
ENSDART00000089433 ; ctdsplb-201; intron 4
Database links

Mature sequence dre-miR-26a-5p

Accession MIMAT0001794
Previous IDsdre-miR-26a
Sequence

37 - 

uucaaguaauccaggauaggcu

 - 58

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-26a-2-3p

Accession MIMAT0031948
Sequence

73 - 

ccuauucaugauuacuugcacu

 - 94

Get sequence
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).