Stem-loop sequence dre-mir-26a-3

AccessionMI0001926 (change log)
Previous IDsdre-mir-26a-4
DescriptionDanio rerio miR-26a-3 stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     aag     a  ---g   ca  -gu            ug  u         c          uugug   u 
5' cu   cugau cu    agu  gu   guggcugcaacc  gu caaguaauc aggauaggcu     gac a
   ||   ||||| ||    |||  ||   ||||||||||||  || ||||||||| ||||||||||     |||  
3' ga   gacua ga    uca  ca   caucgacguugg  ca guucauugg ucuuguccgg     uug g
     gaa     -  agaa   -a  aau            gu  c         u          -----   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr24: 20470954-20471090 [-]
sense
OTTDART00000039206 ; ctdspla-003; exon 1
OTTDART00000039205 ; ctdspla-002; intron 3
OTTDART00000039208 ; ctdspla-005; intron 3
OTTDART00000039204 ; ctdspla-001; intron 4
ENSDART00000132626 ; ctdspla-003; exon 1
ENSDART00000132086 ; ctdspla-002; intron 3
ENSDART00000140651 ; ctdspla-005; intron 3
ENSDART00000089428 ; ctdspla-001; intron 4
ENSDART00000089430 ; ctdspla-201; intron 4
Database links

Mature sequence dre-miR-26a-5p

Accession MIMAT0001794
Previous IDsdre-miR-26a
Sequence

39 - 

uucaaguaauccaggauaggcu

 - 60

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).