Stem-loop sequence dre-mir-26b

AccessionMI0001927 (change log)
DescriptionDanio rerio miR-26b stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     auu       ug     uu         c         -----    u 
5' gc   uggccuu  ccugg  caaguaauc aggauaggu     uagu c
   ||   |||||||  |||||  ||||||||| |||||||||     ||||  
3' cg   aucggag  ggacu  guucauugg ucuuauccg     auca c
     agc       ga     uu         u         gcaug    c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 24675207-24675303 [-]
sense
OTTDART00000028068 ; ctdsp2-001; intron 4
OTTDART00000028070 ; ctdsp2-003; intron 4
ENSDART00000104035 ; ctdsp2-001; intron 4
ENSDART00000137313 ; ctdsp2-003; intron 4
KZ115688.1: 295804-295900 [-]
sense
OTTDART00000028068 ; ctdsp2-001; intron 4
OTTDART00000028070 ; ctdsp2-003; intron 4
ENSDART00000104035 ; ctdsp2-001; intron 4
ENSDART00000137313 ; ctdsp2-003; intron 4
Database links

Mature sequence dre-miR-26b

Accession MIMAT0001795
Sequence

20 - 

uucaaguaauccaggauagguu

 - 41

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).