Stem-loop sequence dre-mir-27a

AccessionMI0001928 (change log)
DescriptionDanio rerio miR-27a stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u    aua    g  ugc  -aa      u    u  a          cacu         gaucuc  a 
5'  cugg   ugau uc   ug   guuucg gagg gc ggacuuagcu    cugugaaca      gg u
    ||||   |||| ||   ||   |||||| |||| || ||||||||||    |||||||||      ||  
3'  gacc   acua ag   ac   cggagu cucc cg cuugaaucgg    gacacuugu      cc a
   g    --g    a  cuc  acc      -    u  c          ---u         ----au  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 33902325-33902455 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-27a
dre-mir-23a-3chr2: 33900435-33900512 [+]
dre-mir-27achr2: 33902325-33902455 [+]
dre-mir-24bchr2: 33905762-33905845 [+]
Database links

Mature sequence dre-miR-27a-5p

Accession MIMAT0031949
Sequence

37 - 

aggacuuagcucacucugugaaca

 - 60

Get sequence
Evidence not experimental
Database links

Mature sequence dre-miR-27a-3p

Accession MIMAT0001796
Previous IDsdre-miR-27a
Sequence

79 - 

uucacaguggcuaaguuccgcu

 - 100

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).