Stem-loop sequence dre-mir-27b

AccessionMI0001929
DescriptionDanio rerio miR-27b stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
           ag                   auug        u  uu 
5' ucuuuucu  caggugcagagcuuagcug    gugaacag ga  g
   ||||||||  |||||||||||||||||||    |||||||| ||   
3' aggagagg  gucuacgucuugaaucggu    cacuuguu cu  a
           -a                   --ga        u  ca 
Get sequence
Deep sequencing
3126 reads, 606 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
8: 31015477-31015567 [-]
sense
OTTDART00000035785 ; zgc:162939-004; intron 5
OTTDART00000035782 ; zgc:162939-002; intron 6
OTTDART00000035783 ; zgc:162939-001; intron 15
ENSDART00000139864 ; C8H9orf3-004; intron 5
ENSDART00000143809 ; C8H9orf3-001; intron 6
ENSDART00000111358 ; C8H9orf3-002; intron 15
Clustered miRNAs
< 10kb from dre-mir-27b
dre-mir-27b8: 31015477-31015567 [-]
dre-mir-24-38: 31010534-31010675 [-]
Database links

Mature sequence dre-miR-27b-5p

Accession MIMAT0031950
Sequence

18 - 

agagcuuagcugauuggugaaca

 - 40

Get sequence
Deep sequencing606 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-27b-3p

Accession MIMAT0001797
Previous IDsdre-miR-27b
Sequence

57 - 

uucacaguggcuaaguucugca

 - 78

Get sequence
Deep sequencing2231 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).