Stem-loop sequence dre-mir-27c-1

AccessionMI0001930
Previous IDsdre-mir-27c
DescriptionDanio rerio miR-27c-1 stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       gugu    u            c   u       a  cauc 
5' gguu    ggug caggacuuaacc acu gugaaca ug    g
   ||||    |||| |||||||||||| ||| ||||||| ||     
3' ccag    ccgc gucuugaauugg uga cacuugu ac    a
       aucc    c            -   -       a  uuca 
Get sequence
Deep sequencing
702 reads, 264 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
3: 13208959-13209046 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-27c-1
dre-mir-23a-23: 13208734-13208831 [+]
dre-mir-27c-13: 13208959-13209046 [+]
dre-mir-24-23: 13215487-13215568 [+]
Database links

Mature sequence dre-miR-27c-5p

Accession MIMAT0003401
Previous IDsdre-miR-27c*
Sequence

19 - 

cuuaacccacuugugaacaaug

 - 40

Get sequence
Deep sequencing27 reads, 3 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-27c-3p

Accession MIMAT0001798
Previous IDsdre-miR-27c
Sequence

56 - 

uucacagugguuaaguucugc

 - 76

Get sequence
Deep sequencing1006 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).