Stem-loop sequence dre-mir-27d

AccessionMI0001931 (change log)
DescriptionDanio rerio miR-27d stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u   gag      c            auug       --u    g 
5'  ucu   cgggug agagcuuggcug    gugaacg   gcau g
    |||   |||||| ||||||||||||    |||||||   |||| c
3'  aga   gcccac ucuugaaucggu    cacuugu   ugug u
   a   aaa      u            --ga       uuu    u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 15954727-15954815 [+]
antisense
OTTDART00000043259 ; si:dkey-3h23.2-002; intron 2
OTTDART00000043258 ; si:dkey-3h23.2-001; intron 3
ENSDART00000142357 ; si:dkey-3h23.2-002; intron 2
ENSDART00000144692 ; si:dkey-3h23.2-001; intron 3
Clustered miRNAs
< 10kb from dre-mir-27d
dre-mir-23bchr10: 15954579-15954659 [+]
dre-mir-27dchr10: 15954727-15954815 [+]
dre-mir-24-1chr10: 15960835-15960914 [+]
Database links

Mature sequence dre-miR-27d

Accession MIMAT0001799
Sequence

57 - 

uucacaguggcuaaguucuuca

 - 78

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).